Quick Order

Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
WTAPcDNA Clone Product Information
cDNA Size:1191
cDNA Description:ORF Clone of Homo sapiens Wilms tumor 1 associated protein DNA.
Gene Synonym:KIAA0105, MGC3925
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG12018-ACG$325
Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG12018-ACR$325
Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG12018-ANG$325
Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG12018-ANR$325
Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG12018-CF$295
Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG12018-CH$295
Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG12018-CM$295
Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG12018-CY$295
Human WTAP Gene cDNA Clone (full-length ORF Clone)HG12018-G$125
Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG12018-G-F$325
Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG12018-G-N$325
Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG12018-NF$295
Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG12018-NH$295
Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG12018-NM$295
Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG12018-NY$295
Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG12018-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Wilms' tumor 1-associating protein (WTAP) was previously identified as a protein associated with Wilms' tumor-1 (WT-1) protein that is essential for the development of the genitourinary system. WT1 was originally identified as a tumor suppressor for Wilms' tumor, but it is also overexpressed in a variety of cancer cells. The WTAP-WT1 axis in vascular cells suggest that WTAP is a vital and multifaceted regulator of vascular remodeling. WTAP has been suggested to function in alternative splicing, stabilization of mRNA, and cell growth. Knocking down endogenous WTAP increased Smooth muscle cells (SMCs) proliferation, because of increased DNA synthesis and G(1)/S phase transition, together with reduced apoptosis. These effects could be the result of WTAP suppressing the transcriptional activity of WT1 in SMCs. WTAP may thus also play a role in messenger RNA processing in mammalian cells, either dependent on or independent of its interaction with WT1.

  • Fukusumi Y, et al. (2008) Wtap is required for differentiation of endoderm and mesoderm in the mouse embryo. Dev Dyn. 237(3): 618-29.
  • Small TW, et al. (2007) Vascular biology and the sex of flies: regulation of vascular smooth muscle cell proliferation by wilms' tumor 1-associating protein. Trends Cardiovasc Med. 17(7): 230-4.
  • Small TW, et al. (2006) Wilms' tumor 1-associating protein regulates the proliferation of vascular smooth muscle cells. Circ Res. 99(12): 1338-46.
  • Rong Y, et al. (2006) Wilms' tumor 1 and signal transducers and activators of transcription 3 synergistically promote cell proliferation: a possible mechanism in sporadic Wilms' tumor. Cancer Res. 66(16): 8049-57.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items