After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human UBE2E1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
UBE2E1cDNA Clone Product Information
Gene_bank_ref_id:NM_003341.3
cDNA Size:572
cDNA Description:ORF Clone of Homo sapiens ubiquitin-conjugating enzyme E2E 1 (UBC4/5 homolog, yeast) DNA.
Gene Synonym:UBCH6, UBE2E1
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Ubiquitin-conjugating enzyme E2E1 (UBE2E1) is a member of the ubiquitin-donjugating enzyme family. UBE2E1 is a protein localized to the nucleus. The modification of proteins with ubiquitin is an importantly step for targeting abnormal or short-lived proteins for degeneration. It has been demonstrated to be released to Sjogrens's syndrome and systemic lupus Erythematosus. Patients with the systemic autoimmune diseases Sjogrens's syndrome and systemic lupus erythematosus often have autoantibodies against the intracellular protein Ro52 that is an E3 ligase dependent on the ubiquitin conjugation enzymes UBE2E1. Ro52 mediates ubiquitination through UBE2D1 in the cytoplasm and through UBE2E1 in the nucleus.

References
  • Nuber U, et al. (1996) Cloning of human ubiquitin-conjugating enzymes UbcH6 and UbcH7 (E2-F1) and characterization of their interaction with E6-AP and RSP5. J Biol Chem. 271(5): 2795-800.
  • Espinosa A, et al. (2008) The autoantigen Ro52 is an E3 ligase resident in the cytoplasm but enters the nucleus upon cellular exposure to nitric oxide. Exp Cell Res. 314(20): 3605-13.
  • Anan T, et al. (1998) Human ubiquitin-protein ligase Nedd4: expression, subcellular localization and selective interaction with ubiquitin-conjugating enzymes. Genes Cells. 3(11): 751-63.
  • Size / Price
    Catalog:HG12003-CM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"