Quick Order

Human KEAP1 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KEAP1 cDNA Clone Product Information
Gene_bank_ref_id:NM_012289.3
RefSeq ORF Size:1865bp
cDNA Description:Full length Clone DNA of Homo sapiens kelch-like ECH-associated protein 1 with C terminal Myc tag.
Gene Synonym:INrf2, KLHL19, MGC1114, MGC4407, MGC9454, KIAA0132, MGC10630, MGC20887, KEAP1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:pCMV3-KEAP1-Myc
Restriction Site:KpnI + XbaI (6kb + 1.92kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1413 C/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Kelch-like ECH-associated protein 1, also known as cytosolic inhibitor of Nrf2, Kelch-like protein 19, KEAP1 and INRF2, is a cytoplasm and nucleus protein which contains one BACK (BTB/Kelch associated) domain, one BTB (POZ) domain and six Kelch repeats. KEAP1 / INRF2 is broadly expressed, with highest levels in skeletal muscle. KEAP1 / INRF2 is a key regulator of the NRF2 transcription factor, which transactivates the antioxidant response element (ARE) and upregulates numerous proteins involved in antioxidant defense. Under basal conditions, KEAP1 / INRF2 targets NRF2 for ubiquitination and proteolytic degradation and as such is responsible for the rapid turnover of NRF2. KEAP1 / INRF2 retains NFE2L2 / NRF2 in the cytosol. KEAP1 / INRF2 functions as substrate adapter protein for the E3 ubiquitin ligase complex formed by CUL3 and RBX1. It targets NFE2L2 / NRF2 for ubiquitination and degradation by the proteasome, thus resulting in the suppression of its transcriptional activity and the repression of antioxidant response element-mediated detoxifying enzyme gene expression. KEAP1 / INRF2 may also retain BPTF in the cytosol. It targets PGAM5 for ubiquitination and degradation by the proteasome.

References
  • Strachan GD. et al., 2004, Biochemistry. 43: 12113-22.
  • Zhang DD. et al., 2004, Mol Cell Biol. 24: 10941-53.
  • Zhang DD. et al., 2003, Mol Cell Biol. 23: 8137-51.
  • Lo S-C. et al., 2006, J Biol Chem. 281: 37893-903.
  • Buckley BJ. et al., 2008, Free Radic Biol Med. 44 (4) :692-8.
  • Size / Price
    Catalog: HG11981-CM
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"