Quick Order

Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
XIAPcDNA Clone Product Information
cDNA Size:1494
cDNA Description:ORF Clone of Homo sapiens X-linked inhibitor of apoptosis DNA.
Gene Synonym:API3, ILP1, MIHA, XLP2, BIRC4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10606-ACG$325
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10606-ACR$325
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10606-ANG$325
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10606-ANR$325
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10606-CF$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10606-CH$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10606-CM$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10606-CY$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone)HG10606-M$95
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10606-M-N$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10606-NF$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10606-NH$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10606-NM$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10606-NY$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10606-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

E3 ubiquitin-protein ligase XIAP / BIRC4, also known as inhibitor of apoptosis protein 3, X-linked inhibitor of apoptosis protein, and IAP-like protein, is a protein that belongs to a family of apoptotic suppressor proteins. Members of this family share a conserved motif termed, baculovirus IAP repeat, which is necessary for their anti-apoptotic function. XIAP / BIRC4 functions through binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2 and inhibits apoptosis induced by menadione, a potent inducer of free radicals, and interleukin 1-beta converting enzyme. XIAP / BIRC4 also inhibits at least two members of the caspase family of cell-death proteases, caspase-3 and caspase-7. Mutations in this encoding gene are the cause of X-linked lymphoproliferative syndrome. Alternate splicing results in multiple transcript variants. Thought to be the most potent apoptosis suppressor, XIAP / BIRC4, directly binds and inhibits caspases -3, -7 and -9. Survivin, which also binds to several caspases, is up-regulated in a many tumour cell types. Defects in XIAP / BIRC4 are the cause of lymphoproliferative syndrome X-linked type 2 (XLP2). XLP is a rare immunodeficiency characterized by extreme susceptibility to infection with Epstein-Barr virus (EBV). Symptoms include severe or fatal mononucleosis, acquired hypogammaglobulinemia, pancytopenia and malignant lymphoma.

  • Holcik M, et al. (2000) Functional Characterization of the X-Linked Inhibitor of Apoptosis (XIAP) Internal Ribosome Entry Site Element: Role of La Autoantigen in XIAP Translation. Mol Cell Biol. 20 (13): 4648-57.
  • Winsauer G, et al. (2008) XIAP regulates bi-phasic NF-kappaB induction involving physical interaction and ubiquitination of MEKK2. Cell Signal. 20 (11): 2107-12.
  • Suzuki Y, et al. (2001) X-linked inhibitor of apoptosis protein (XIAP) inhibits caspase-3 and -7 in distinct modes. J Biol Chem. 276 (29): 27058-63.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items