After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human C1QBP Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
C1QBPcDNA Clone Product Information
cDNA Size:849
cDNA Description:ORF Clone of Homo sapiens complement component 1, q subcomponent binding protein DNA.
Gene Synonym:p32, HABP1, gC1qR, GC1QBP, SF2p32, gC1Q-R
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Hyaluronan binding protein 1 (HABP1), also known as p32 or gC1qR, is a ubiquitously expressed multifunctional phospho-protein implicated in cell signalling. Hyaluronan-binding protein 1 (HABP1) /p32/gC1qR was characterized as a highly acidic and oligomeric protein, which binds to different ligands like hyaluronan, C1q, and mannosylated albumin. The role of hyaluronan binding protein 1 (HABP1) in cell signaling was investigated and in vitro. HABP1 overexpressing cells showed extensive vacuolation and reduced growth rate, which was corrected by frequent medium replenishment. Further investigation revealed that HABP1 overexpressing cells undergo apoptosis, and they failed to enter into the S-phase. The sperm surface HABP1 level can be correlated with the degree of sperm motility.Hyaluronan binding protein 1 (HABP1) was reported to be present on human sperm surface and its involvement in fertilization has already been elucidated: decreased HABP1 level may be associated with low motility of sperms, which in turn might cause infertility in the patient. HABP1 also is an endogenous substrate for MAP kinase and upon mitogenic stimulation it is translocated to the nucleus in a MAP kinase-dependent manner.

  • Meenakshi J, et al. (2003) Constitutive expression of hyaluronan binding protein 1 (HABP1/p32/gC1qR) in normal fibroblast cells perturbs its growth characteristics and induces apoptosis. Biochemicaland Biophysical Research Communication. 300(3): 686-93.
  • Majumdar M, et al. (2002) Hyaluronan Binding Protein 1 (HABP1) /C1QBP/p32 Is an Endogenous Substrate for MAP Kinase and Is Translocated to the Nucleus upon Mitogenic Stimulation. Biochemical and Biophysical Research Communications. 291(4): 829-37.
  • Ghosh I, et al. (2002) Reduction in the level of hyaluronan binding protein 1 (HABP1) is associated with loss of sperm motility. Journal of Reproductive Immunology. 53(1-2): 45-54.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availsability:2-3 weeks