Quick Order

Human CSF1 transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CSF1cDNA Clone Product Information
cDNA Size:1665
cDNA Description:ORF Clone of Homo sapiens colony stimulating factor 1 (macrophage) transcript variant 4 DNA.
Gene Synonym:MCSF, CSF-1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human CSF1 transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Human CSF1 transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11792-ACG$345
Human CSF1 transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11792-ACR$345
Human CSF1 transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11792-CF$315
Human CSF1 transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11792-CH$315
Human CSF1 transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11792-CM$315
Human CSF1 transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11792-CY$315
Human CSF1 transcript variant 4 Gene cDNA Clone (full-length ORF Clone)HG11792-G$195
Human CSF1 transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11792-G-N$395
Human CSF1 transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11792-NF$315
Human CSF1 transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11792-NH$315
Human CSF1 transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11792-NM$315
Human CSF1 transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11792-NY$315
Human CSF1 transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11792-UT$315
 Learn more about expression Vectors
Colony-Stimulating Factor (CSF) & Receptor Related Products

Macrophage colony-stimulating factor 1, also known as CSF-1, M-CSF, Lanimostim and CSF1, is a single-pass membrane protein which is disulfide-linked as a homodimer or heterodimer. Granulocyte / macrophage colony-stimulating factors are cytokines that act in hematopoiesis by controlling the production, differentiation, and function of 2 related white cell populations of the blood, the granulocytes and the monocytes-macrophages. M-CSF/CSF-1 is known to facilitate monocyte survival, monocyte-to-macrophage conversion, and macrophage proliferation. M-CSF/CSF-1 is a secreted cytokine which influences hemopoietic stem cells to differentiate into macrophages or other related cell types. It binds to the Colony stimulating factor 1 receptor. M-CSF/CSF-1 may also be involved in development of the placenta. The active form of M-CSF/CSF-1 is found extracellularly as a disulfide-linked homodimer, and is thought to be produced by proteolytic cleavage of membrane-bound precursors. M-CSF/CSF-1 induces cells of the monocyte/macrophage lineage. It also plays a role in immunological defenses, bone metabolism, lipoproteins clearance, fertility and pregnancy. Upregulation of M-CSF/CSF-1 in the infarcted myocardium may have an active role in healing not only through its effects on cells of monocyte/macrophage lineage, but also by regulating endothelial cell chemokine expression.

  1. Pandit J. et al., 1992, Science. 258: 1358-62.
  2. Tokai M. et al., 2000, J Bacteriol. 182 (10): 2865-8.
  3. Fan X. et al., 2001, Am J Physiol Endocrinol Metab. 280 (1): E103-11.
  4. Frangogiannis NG. et al., 2003, Am J Physiol Heart Circ Physiol. 285 (2): H483-92.
  5. Cupp JS. et al., 2007, Am J Surg Pathol. 31 (6): 970-6.