Quick Order

Human CEACAM8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CEACAM8cDNA Clone Product Information
cDNA Size:1050
cDNA Description:ORF Clone of Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 8 DNA.
Gene Synonym:CD66b
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

CEACAM8, also known as CD66b or NCA-95, is a single chain, GPI-anchored, highly glycosylated protein belonging to the carcinoembryonic antigen family. There are four members in this family: CD66a, CD66b, CD66c, and CD66d. Members of CEACAM family are widely expressed especially on human neutrophils, and, depending on the tissue, capable of regulating diverse functions including tumor promotion, tumor suppression, angiogenesis, and neutrophil activation. Abnormal overexpression and downregulation of some CEACAMs have been described in tumor cells. Monoclonal antibodies grouped in the CD66 cluster recognize CEACAM members. Ectopic CD66 expression is commonly detected in B-cell lineage acute lymphoblastic leukemia (ALL). CEACAM8(CD66b) is also an activation marker for human granulocytes. However, its biological functions are largely unknown in eosinophils. It has been reported that CD66b is highly expressed on the surface of human peripheral blood eosinophils isolated from healthy individuals. Engagement of CD66b by mAb or a natural ligand, galectin-3, activated a Src kinase family molecule, hemopoietic cell kinase (Hck), and induced cellular adhesion, superoxide production, and degranulation of eosinophils. CD66b molecules were localized in lipid rafts, and disruption of lipid rafts or removal of the GPI anchor inhibited the adhesion and activation of eosinophils. Importantly, CD66b was constitutively and physically associated with a beta2 integrin, CD11b, and cross-linking of CD66b induced a striking clustering of CD11b molecules. Thus, CD66b molecules are involved in regulating adhesion and activation of eosinophils, possibly through their localization in lipid rafts and interaction with other cell surface molecules, such as CD11b. Binding of exogenous or endogenous carbohydrate ligands(s) to CD66b may be important in the release of proinflammatory mediators by human eosinophils.

  • Yoon J, et al. (2007) CD66b regulates adhesion and activation of human eosinophils. J Immunol. 179 (12): 8454-62.
  • Skubitz KM, et al. (1996) CD6a, CD66b, CD66c, and CD66d each independently stimulate neutrophils. J Leukoc Biol. 60 (1): 106-17.
  • Skubitz KM, et al. (2008) Inte rdependency of CEACAM-1, -3, -6, and -8 induced human neutrophil adhesion to endothelial cells. J Transl Med. 6: 78.
  • Lasa A, et al. (2008) High expression of CEACAM6 and CEACAM8 mRNA in acute lymphoblastic leukemias. Ann Hematol. 87 (3): 205-11.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items