Quick Order

Text Size:AAA

Human VNN2 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human VNN2 cDNA Clone Product Information
Gene_bank_ref_id:NM_004665.2
RefSeq ORF Size:1563bp
cDNA Description:Full length Clone DNA of Homo sapiens vanin 2 with C terminal Myc tag.
Gene Synonym:FOAP-4, GPI-80
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Vascular non-inflammatory molecule 2, also known as glycosyl-phosphatidyl inositol-anchored protein GPI-80, Vanin-2, Protein FOAP-4 and VNN2, is a cell membrane protein which belongs to the CN hydrolase family and Vanin subfamily. VNN2 is widely expressed with higher expression in spleen and blood. VNN2 is a member of the vanin family of proteins which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. VNN2 is an amidohydrolase that hydrolyzes specifically one of the carboamide linkages in D-pantetheine thus recycling pantothenic acid (vitamin B5) and releasing cysteamine. It is involved in the thymus homing of bone marrow cells. VNN2 plays a role in transendothelial migration of neutrophils and may regulate beta-2 integrin-mediated cell adhesion, migration and motility of neutrophil.

References
  • Suzuki K. et al., 1999, J. Immunol. 162: 4277-84.
  • Martin, F. et al., 2001,Immunogenetics. 53 (4):296-306.
  • Liu T.et al., 2005, J. Proteome Res. 4: 2070-80.
  • Jansen P.AM. et al., 2009, J. Invest. Dermatol. 129: 2167-74.
  • Size / Price
    Catalog: HG11728-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"