After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SLAMF7 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SLAMF7 cDNA Clone Product Information
Gene_bank_ref_id:NM_021181
RefSeq ORF Size:1008bp
cDNA Description:Full length Clone DNA of Homo sapiens SLAM family member 7 with C terminal Myc tag.
Gene Synonym:CRACC, 19A, CS1, CD319
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

SLAM family member 7 (SLAMF7), also known as CRACC, CD319, CD2-like receptor-activating cytotoxic cells, and CS1, is a single-pass type I membrane protein and a member of the CD2 family of cell surface receptors. SLAMF7 is expressed in NK cells, activated B-cells, NK-cell line but not in promyelocytic, B-cell lines, or T-cell lines. Although the cytoplasmic domain of CS1 contains immunoreceptor tyrosine-based switch motifs (ITSM), which enables to recruite signaling lymphocyte activation molecule (SLAM)-associated protein (SAP/SH2D1A), it activates NK cells in the absence of a functional SAP. CS1 is a self ligand and homophilic interaction of CS1 regulates NK cell cytolytic activity. CRACC positively regulated natural killer cell functions by a mechanism dependent on the adaptor EAT-2 but not the related adaptor SAP. However, in the absence of EAT-2, CRACC potently inhibited natural killer cell function. It was also inhibitory in T cells, which are typically devoid of EAT-2. Thus, CRACC can exert activating or inhibitory influences on cells of the immune system depending on cellular context and the availability of effector proteins.

References
  • Lee JK, et al. (2004) Molecular and functional characterization of a CS1 (CRACC) splice variant expressed in human NK cells that does not contain immunoreceptor tyrosine-based switch motifs. Eur J Immunol. 34(10): 2791-9.
  • Tassi I, et al. (2005) The cytotoxicity receptor CRACC (CS-1) recruits EAT-2 and activates the PI3K and phospholipase Cgamma signaling pathways in human NK cells. J Immunol. 175(12): 7996-8002.
  • Lee JK, et al. (2007) CS1 (CRACC, CD319) induces proliferation and autocrine cytokine expression on human B lymphocytes. J Immunol. 179(7): 4672-8.
  • Cruz-Munoz ME, et al. (2009) Influence of CRACC, a SLAM family receptor coupled to the adaptor EAT-2, on natural killer cell function. Nat Immunol. 10(3): 297-305.
  • Size / Price
    Catalog: HG11691-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"