After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human TGFBI ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TGFBI cDNA Clone Product Information
Gene_bank_ref_id:NM_000358.2
RefSeq ORF Size:2052bp
cDNA Description:Full length Clone DNA of Homo sapiens transforming growth factor, beta-induced, 68kDa with N terminal Myc tag.
Gene Synonym:CSD, CDB1, CDG2, CSD1, CSD2, CSD3, EBMD, LCD1, BIGH3, CDGG1
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

TGFBI is an RGD-containing protein that binds to type I, II and IV collagens. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. TGFBI plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage. TGFBI is induced by transforming growth factor-beta and acts to inhibit cell adhesion. Mutations in TGFBI are associated with multiple types of corneal dystrophy. TGFBI can bind to type I, II, and IV collagens. This adhesion protein may play an important role in cell-collagen interactions. In cartilage, TGFBI may be involved in endochondral bone formation. Loss of the TGFBI is sufficient to induce specific resistance.

References
  • Kannabiran C, et al. (2006) TGFBI gene mutations in corneal dystrophies. Hum Mutat. 27(7): 615-25.
  • Size / Price
    Catalog: HG10569-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"