Quick Order

Human TCN2 ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human TCN2 cDNA Clone Product Information
NCBI RefSeq:NM_000355.2
RefSeq ORF Size:1284bp
cDNA Description:Full length Clone DNA of Homo sapiens transcobalamin II; macrocytic anemia with N terminal Myc tag.
Gene Synonym:TC2, D22S676, D22S750
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Transcobalamin II, also known as TCN2 and TC II, is a plasma protein that binds cobalamin (Cbl; vitamin B12) as it is absorbed in the terminal ileum and distributes to tissues. The circulating transcobalamin II-cobalamin complex binds to receptors on the plasma membrane of tissue cells and is then internalized by receptor-mediated endocytosis. Transcobalamin II is a non-glycolated secretory protein of molecular mass 43 kDa. Its plasma membrane receptor (TC II-R) is a heavily glycosylated protein with a monomeric molecular mass of 62 kDa. Human TCN2 gene is composed of nine exons and eight introns spanning approximately 20 kb with multiple potential transcription start sites. A number of genetic abnormalities are characterized either by a failure to express TCN2 or by synthesis of an abnormal protein. The TCN2 deficiency results in cellular cobalamin deficiency, an early onset of megaloblastic anaemia, and neurological abnormalities.

References
  • Rothenberg, S. P. et al., 1995, Baillieres Clin Haematol. 8 (3):499-514.
  • Bibi, H. et al., 1999, J Inherit Metab Dis. 22 (7):765-772.
  • Seetharam,B. et al.,2000, Vitam Horm. 59 :337-366. 
  • Size / Price
    Catalog: HG10566-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"