Quick Order

Human CLEC4M / CD299 / DC-SIGNR ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CLEC4M cDNA Clone Product Information
Gene_bank_ref_id:NM_014257.3
RefSeq ORF Size:1200bp
cDNA Description:Full length Clone DNA of Homo sapiens C-type lectin domain family 4, member M with N terminal Myc tag.
Gene Synonym:CD299, LSIGN, CD209L, L-SIGN, DCSIGNR, HP10347, DC-SIGN2, DC-SIGNR, MGC47866, MGC129964
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

C-type lectin domain family 4, member M, also known as DC-SIGNR and CLEC4M, is a type II integral membrane protein that is 77% amino acid identical to DC-SIGN, an HIV gp120-binding protein. Though the encoded gene located in the same chromosome, DC-SIGN is expressed solely on dendritic cells, while DC-SIGNR is predominantly found in liver sinusoidal endothelial cells and lymph node, as well as placental endothelium. DC-SIGNR exists as a homotetramer, and the tandem repeat domain, also called neck domain, mediates oligermerization. DC-SIGNR is ragarded as a pathogen-recognition receptor involved in peripheral immune surveillance in liver, and probably mediate the endocytosis of pathogens which are subsequently degraded in lysosomal compartments. DC-SIGNR appears to selectively recognize and bind many viral surface glycoproteins containing high mannose N-linked oligosaccharides in a calcium-dependent manner, including HIV-1 gp120, HIV-2 gp120, SIV gp120, ebolavirus glycoproteins, HCV E2, and human SARS coronavirus protein S, as well as the cellular adhesion protein ICAM3. DC-SIGNR have been thought to play an important role in establishing HIV infection by enhancing trans-infection of CD4(+)T cells in the regional lymph nodes. It may affect susceptibility to HIV infection by a mechanism that is different in females and males. DC-SIGNR can bind to hepatitis C virus (HCV), and its polymorphism might affect HCV loads supporting the concept that DC-SIGNR contributes to HCV replication efficacy.

References
  • Nattermann J, et al. (2006) The tandem-repeat polymorphism of the DC-SIGNR gene in HCV infection. J Viral Hepat. 13(1): 42-6.
  • Wichukchinda N, et al. (2007) The polymorphisms in DC-SIGNR affect susceptibility to HIV type 1 infection. AIDS Res Hum Retroviruses. 23(5): 686-92.
  • Size / Price
    Catalog: HG10559-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"