Quick Order

Text Size:AAA

Human JAG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
JAG1cDNA Clone Product Information
cDNA Size:3702
cDNA Description:ORF Clone of Homo sapiens collagen triple helix repeat containing 1 DNA.
Gene Synonym:AGS, AHD, AWS, HJ1, CD339, JAGL1, MGC104644, JAG1
Restriction Site:HindIII + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 402 G/A, 2526 C/T and 3417 T/C not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Protein Jagged 1, also known as JAG1, JAGL1 and CD339, is a single-pass type I  membrane protein which contains 1 DSL domain and 15 EGF-like domains. JAG1/Jagged 1 is widely expressed in adult and fetal tissues. The expression of JAG1/Jagged 1 is up-regulated in cervical squamous cell carcinoma. JAG1/Jagged 1 is also expressed in bone marrow cell line HS-27a which supports the long-term maintenance of immature progenitor cells. JAG1/Jagged 1 is a ligand for multiple Notch receptors. It is involved in the mediation of Notch signaling. JAG1/Jagged 1 may be involved in cell-fate decisions during hematopoiesis. 

JAG1/Jagged 1 seems to be involved in early and late stages of mammalian cardiovascular development. It inhibits myoblast differentiation and enhances fibroblast growth factor-induced angiogenesis. Defects in JAG1/Jagged 1 are the cause of Alagille syndrome type 1 (ALGS1). Alagille syndrome is an autosomal dominant multisystem disorder defined clinically by hepatic bile duct paucity and cholestasis in association with cardiac, skeletal, and ophthalmologic manifestations. Defects in JAG1/Jagged 1 are also a cause of tetralogy of Fallot (TOF). TOF is a congenital heart anomaly which consists of pulmonary stenosis, ventricular septal defect, dextroposition of the aorta (aorta is on the right side instead of the left) and hypertrophy of the right ventricle. This condition results in a blue baby at birth due to inadequate oxygenation.

JAG1 / Jagged 1 Related Studies
  1. Oda T.et al., 1997, Nat. Genet. 16:235-242.
  2. Krantz I.D. et al., 1998, Am. J. Hum. Genet. 62:1361-1369.
  3. Li L. et al., 1998, Immunity. 8:43-55.
  4. Jones E.A. et al., 2000, J. Med. Genet. 37: 658-662.
  5. Roepke A.et al., 2003, Hum. Mutat. 21:100-100.
  6. Jurkiewicz D.et al., 2005, Hum. Mutat. 25:321-321.
  7. Warthen D.M.et al., 2006, Hum. Mutat. 27:436-443.
Size / Price
List Price: $445.00  (Save $0.00)
Price:$445.00      [How to order]
Availability5 Business days
  • Human JAG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged
Recently Viewed Items