After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ACP5 / TRAP transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ACP5cDNA Clone Product Information
cDNA Size:978
cDNA Description:ORF Clone of Homo sapiens acid phosphatase 5, tartrate resistant , transcript variant 4 DNA.
Gene Synonym:TRAP, MGC117378
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human ACP5 / TRAP transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Human ACP5 / TRAP transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10550-ACG$325
Human ACP5 / TRAP transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10550-ACR$325
Human ACP5 / TRAP transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10550-CF$295
Human ACP5 / TRAP transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10550-CH$295
Human ACP5 / TRAP transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10550-CM$295
Human ACP5 / TRAP transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10550-CY$295
Human ACP5 / TRAP transcript variant 4 Gene cDNA Clone (full-length ORF Clone)HG10550-M$95
Human ACP5 / TRAP transcript variant 4 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10550-M-F$295
Human ACP5 / TRAP transcript variant 4 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10550-M-N$295
Human ACP5 / TRAP transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10550-NF$295
Human ACP5 / TRAP transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10550-NH$295
Human ACP5 / TRAP transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10550-NM$295
Human ACP5 / TRAP transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10550-NY$295
Human ACP5 / TRAP transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10550-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Tartrate-resistant acid phosphatase (TRACP) or acid phosphatase 5, tartrate resistant (ACP5 or TRAP) is a glycosylated monomeric metalloenzyme expressed in mammals. TRACP is associated with osteoblast migration to bone resorption sites, and, once there, TRACP is believed to initiate osteoblast differentiation, activation, and proliferation. TRACP once considered to be just a histochemical marker of osteoclasts is now recognised to be a molecule of widespread occurrence with functions in both the skeleton and the immune system. Two forms of TRACP circulate in human blood, TRACP 5a derived from macrophages and dendritic cells, and TRACP-5b derived from osteoclasts. Recent data have demonstrated the utility of TRACP-5b as a marker of osteoclast number and bone resorption, and serum TRACP-5a as a marker of inflammatory conditions. TRACP is expressed by osteoclasts, macrophages, dendritic cells and a number of other cell types. It has a critical role in many biological processes including skeletal development, collagen synthesis and degradation, the mineralisation of bone, cytokine production by macrophages and dendritic cells, macrophage recruitment, dendritic cell maturation and a role in the development of Th1 responses.

  • Hayman AR. (2008) Tartrate-resistant acid phosphatase (TRAP) and the osteoclast/immune cell dichotomy. Autoimmunity. 41(3): 218-23.
  • Halleen JM, et al. (2006) Tartrate-resistant acid phosphatase 5b (TRACP 5b) as a marker of bone resorption. Clin Lab. 52(9-10): 499-509.
  • Mochizuki Y. (2006) Bone and bone related biochemical examinations. Bone and collagen related metabolites. Tartrate-resistant acid phosphatase (TRACP). Clin Calcium. 16(6): 948-55.
  • Lamp EC, et al. (2000) Biology of tartrate-resistant acid phosphatase. Leuk Lymphoma. 39(5-6): 477-84.