After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ADM ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ADM cDNA Clone Product Information
Gene_bank_ref_id:NM_001124.1
RefSeq ORF Size:558bp
cDNA Description:Full length Clone DNA of Homo sapiens adrenomedullin with C terminal Myc tag.
Gene Synonym:AM, ADM
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Adrenomedullin consists of 52 amino acids and is a member of the adrenomedullin family. It s a a hypotensive peptide and has 1 intramolecular disulfide bond. It seems that adrenomedullin has a slight homology with the calcitonin gene-related peptide. Adrenomedullin has a highly expression in pheochromocytoma and adrenal medulla. It also can be detected in lung, ventricle and kidney tissues. Adrenomedullin and PAMP are potent hypotensive and vasodilatator agents. Numerous actions have been reported most related to the physiologic control of fluid and electrolyte homeostasis. In the kidney, adrenomedullin is diuretic and natriuretic, and both adrenomedullin and PAMP inhibit aldosterone secretion by direct adrenal actions. In pituitary gland, both peptides at physiologically relevant doses inhibit basal ACTH secretion. Both peptides appear to act in brain and pituitary gland to facilitate the loss of plasma volume, actions which complement their hypotensive effects in blood vessels. It is believed that adrenomedullin functions through combinations of the calcitonin receptor like receptor and receptor activity-modifying proteins complexes, as well as CGRP receptors.

References
  • Hao SL, et al. (2011) The antifibrosis effect of adrenomedullin in human lung fibroblasts. Exp Lung Res. 37(10):615-26.
  • Hikosaka T, et al. (2011) Adrenomedullin production is increased in colorectal adenocarcinomas; its relation to matrix metalloproteinase-9. Peptides. 32(9):1825-31.
  • Boc-Zalewska A, et al. (2011) Adrenomedullin mRNA expression in placenta of preeclamptic women. Ginekol Pol. 82(8):585-91.
  • Palladini G, et al. (2011) Midregional proadrenomedullin (MR-proADM) is a powerful predictor of early death in AL amyloidosis. Amyloid. 18(4):216-21.
  • Size / Price
    Catalog: HG11646-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"