After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PCBP1 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PCBP1 cDNA Clone Product Information
Gene_bank_ref_id:NM_006196.3
RefSeq ORF Size:1071bp
cDNA Description:Full length Clone DNA of Homo sapiens poly(rC) binding protein 1 with C terminal Myc tag.
Gene Synonym:HNRPX, HNRPE1, hnRNP-X, hnRNP-E1, PCBP1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Poly(rC)-binding protein 1, also known as Heterogeneous nuclear ribonucleoprotein E1, Alpha-CP1, Nucleic acid-binding protein SUB2.3 and PCBP1, is a family member of heterogeneous nuclear ribonucleoproteins (hnRNPs) that belong to RNA-binding proteins and bear three KH domains. PCBP1 is loosely bound in the nucleus. It may shuttle between the nucleus and the cytoplasm. It is abundantly expressed in skeletal muscle, thymus and peripheral blood leukocytes while a lower expression is observed in prostate, spleen, testis, ovary, small intestine, heart, liver, adrenal and thyroid glands. PCBP1 is widely expressed in many human tissues and involved in regulation of transcription, transportation process, and function of RNA molecules. PCBP1 plays a pivotal role in post-transcriptional regulation for RNA metabolism and RNA function in gene expression. PCBP1 acts as a negative regulator of CD44 variants splicing in HepG2 cells, and loss of PCBP1 in human hepatic tumor contributes to the formation of a metastatic phenotype.

References
  • Evans,J.R. et al., 2003, Oncogene  22 (39): 8012-20.
  • Huo,L.R. et al., 2008, Biochim Biophys Acta  1784 (11):1524-33.
  • Huo,L.R. et al., 2009, Beijing Da Xue Xue Bao  41 (4):402-8.
  • Zhang,T. et al., 2010, Mol Cancer 9 :72.
  • Size / Price
    Catalog: HG11628-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"