Quick Order

Text Size:AAA

Human PAPPA2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PAPPA2cDNA Clone Product Information
cDNA Size:5376
cDNA Description:ORF Clone of Homo sapiens pappalysin 2 , transcript variant 1 DNA.
Gene Synonym:PAPPE, PLAC3, PAPP-A2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human PAPPA2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Related Products
Product nameProduct name

Pappalysin-2/PAPP-A2 is the second member of the pappalysin family of metzincin superfamily, of which PAPP-A is the first member. There is no homology between the prepro-peptides of PAPP-A and PAPP-A2, but 46% of the residues of mature PAPP-A are also present in mature PAPP-A2. PAPP-A specifically cleaves insulin-like growth factor-binding protein(IGFBP)-4, one of six known modulators of IGF-I and –II, whereas PAPP-A2 specifically cleaved IGFBP-5 at one site, between Ser-143 and Lys-144. In contrast to the cleavage of IGFBP-4 by PAPP-A that strictly requires the presence of IGF, the cleavage of IGFBP-5 by PAPP-A2 was IGF-independent. Recent data firmly establish PAPP-A and IGFBP-4 as an important functional pair in several systems. Because of its close relationship with PAPP-A, both structurally and functionally, PAPP-A2 is a likely candidate for IGFBP-5 proteinase in many tissues and conditioned media where IGFBP-5 proteolysis has been reported.

  • Lisbeth S Laursen. et al., 2002, Vol. 277 (49): 47225-34.
  • Michael T Overgaard. et al., 2001, The Journal of Biological Chemistry. 276 (24): 21849-53.
  • Size / Price
    List Price: $845.00  (Save $0.00)
    Price:$845.00      [How to order]
    Availability2-3 weeks