Quick Order

Text Size:AAA

Human ALOX5AP Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ALOX5APcDNA Clone Product Information
cDNA Size:486
cDNA Description:ORF Clone of Homo sapiens arachidonate 5-lipoxygenase-activating protein DNA.
Gene Synonym:FLAP, ALOX5AP
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human ALOX5AP Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Related Products
Product nameProduct name

Arachidonate 5-Lipoxygenase-Activating Protein (ALOX5AP), also known as FLAP, belongs to the MAPEG family. ALOX5AP/FLAP is an essential partner of 5-LO for this process. The FLAP (ALOX5AP) gene has been linked to risk for myocardial infarction, stroke and restenosis, reigniting pharmaceutical interest in this target. It had been found that ALOX5AP/FLAP is a key enzyme in leukotriene formation, in both human pulmonary microvascular endothelial cells and a transformed human brain endothelial cell line. In addition, the protein FLAP has recently been identified as an emerging target in metabolic disease. In fact, FLAP is overexpressed in the adipose tissue of patients and experimental animals with obesity.

  • Gonsalves CS, et al. (2010) Hypoxia-mediated expression of 5-lipoxygenase-activating protein involves HIF-1alpha and NF-kappaB and microRNAs 135a and 199a-5p. J Immunol. 184(7): 3878-88.
  • Zintzaras E, et al. (2009) Variants of the arachidonate 5-lipoxygenase-activating protein (ALOX5AP) gene and risk of stroke: a HuGE gene-disease association review and meta-analysis. Am J Epidemiol. 169(5): 523-32.
  • Evans JF, et al. (2008) What's all the FLAP about?: 5-lipoxygenase-activating protein inhibitors for inflammatory diseases. Trends Pharmacol Sci. 29(2): 72-8.
  • Bck M, et al. (2007) 5-Lipoxygenase-activating protein: a potential link between innate and adaptive immunity in atherosclerosis and adipose tissue inflammation. Circ Res. 100: 946-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items