Quick Order

Text Size:AAA

Cynomolgus monkey CD74 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD74cDNA Clone Product Information
Gene_bank_ref_id:XM_005558265.1
cDNA Size:885
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) CD74 molecule, major histocompatibility complex, class II invariant chain DNA.
Gene Synonym:CD74
Species:Cynomolgus
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD74, also known as HLA class2 histocompatibility antigen gamma chain and HLA-DR antigens-associated invariant chain, is a polypeptide involved in the formation and transport of MHC class2 protein. CD74 is expressed by B cells, macrophages, and Reed-Sternberg cells. When MHC class 2 protein was in the rough ER, its peptide-binding cleft was blocked by CD74 to prevent it from interacting with the endogenous peptides. CD74 also serves to facilitate MHC class2's export from ER.

References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Moynes R, et al. (1997) A marker to distinguish atypical fibroxanthoma from malignant fibrous histiocytoma. Cancer. 79 (11): 2115-24.
  • Gabrielle FA, et al. (2008) Regulation of dendritic cell migration by CD74, the MHC class 2-associated invariant chain. Science. 322 (5908): 1705-10.
  • Leng L, et al. (2003) MIF signal transduction initiated by binding to CD74. JEM.197 (11): 1467-76.
  • Size / Price
    Catalog:CG90682-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"