Quick Order

Human IL17Rd ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IL17RD cDNA Clone Product Information
Gene_bank_ref_id:NM_017563.3
RefSeq ORF Size:2220bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 17 receptor D with N terminal Myc tag.
Gene Synonym:SEF, IL-17RD, IL17RLM, FLJ35755, MGC133309, DKFZp434N1928
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Rhesus IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)Canine IL-17RD Protein (Fc Tag)Rhesus IL17 / IL17a ProteinRhesus IL17BR / IL17RB / IL-17 Receptor B Protein (ECD, His Tag)Human IL17B / IL-17B Protein (Fc Tag)Rat IL17F / IL-17F Protein (His Tag)Canine IL17RD Protein (His Tag)Human IL25 Protein (Fc Tag)Human IL17RD Protein (His Tag)Mouse IL25 Protein (His Tag)Human p38 alpha / MAPK14 Protein (His Tag)Human IL17RA / CD217 Protein (His & Fc Tag)Human ERK2 / MAPK1 / MAPK2 Protein (GST Tag)Human IL17RA / CD217 Protein (His Tag)Human IKB alpha / NFKBIA Protein (His Tag)Mouse IL17RA / IL17R / CD217 Protein (His Tag)Human IL-17F / Interleukin-17F Protein (His Tag)Mouse IL17F / IL-17F Protein (His Tag)Mouse IL17F / IL-17F ProteinHuman p38 delta / MAPK13 Protein (GST Tag)Human IL17RB / IL-17 Receptor B Protein (Flag Tag)Mouse IL17B / IL-17B Protein (Fc Tag)Human RELA / Transcription factor p65 / NFkB p65 Protein (aa 1-306, GST Tag)Human IL17RC Protein (aa 1-454, His Tag)Human IL17RC Protein (Fc Tag)Mouse ERK2 / MAPK1 / MAPK2 Protein (His & GST Tag)Human p38 delta / MAPK13 Protein (Activated in vitro, GST Tag)Human IL17 / IL17A Protein (His Tag)Human IL17 / IL17A ProteinMouse IL17 / IL17A ProteinRat IL17RA / IL17R Protein (His Tag)Human p38 alpha / MAPK14 Protein (His Tag)Rat Interleukin 25 / IL25 / IL17E Protein (Fc Tag)Rhesus IL17RA / IL17R Protein (Fc Tag)Mouse ERK2 / MAPK1 / MAPK2 ProteinMouse IL17BR / IL17RB / IL-17 Receptor B Protein (His Tag)Mouse IL17RA / IL17R / CD217 Protein (Fc Tag)Human IL17 / IL17A Protein (His Tag)Human IL-17F / IL17F ProteinHuman IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)Canine IL17 / IL17A ProteinRat IL17RA / IL17R Protein (Fc Tag)Marmoset IL17 / IL17A ProteinHuman IL17BR / IL17RB / IL-17 Receptor B Protein (His Tag)Human IL17 / IL17A ProteinMouse IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)
Background

Interleukin-17 receptor D (IL-17D) also known as Interleukin-17 receptor-like protein, is a member of interleukine-17 recepter family. IL-17RD functions as a feedback inhibitor of fibroblast growth factor mediated Ras-MAPK signaling and ERK activation. It may inhibit FGF-induced FGFR1 tyrosine phosphorylation, regulate the nuclear ERK signaling pathway by spatially blocking nuclear translocation of activated ERK By similarity, and mediate JNK activation and may be involved in apoptosis. IL-17RD is found expressed in the neopallial cortex, rhombic lip and dorsal regions of the myelencephalon and in the frontal nasal process. IL-17RD is also expressed in the commissural plate and septal area of the forebrain and in the hippocampus, lens and optic cup. In the oral region, IL-17RD is expressed in the tongue and in the mesenchyme of the first branchial arch. It is also expressed in the developing inner ear. IL-17RD interacts with both IL-17R-Myc and IL-17RB-Myc. Both the intracellular and extracellular domains of IL-17RD interact with IL-17R. IL-17R forms a heteromeric complex with IL-17RD. Experiment results indicate that IL-17RD is able to affect IL-17R localization, suggesting that these two molecules are colocalized and associate with each other within cells. The fact that IL-17RD Delta ICD is unable to mediate IL-17 signaling but functions as a dominant-negative form indicates that the intracellular domain of IL-17RD is pivotal. In addition, IL-17RD interacts with the IL-17R downstream molecule TRAF6. It has been proposed that the IL-17RD intracellular domain interacts with IL-17R and TRAF6 to deliver the downstream signal.

References
  • Weaver CT, et al.. (2007) IL-17 family cytokines and the expanding diversity of effector T cell lineages. Annu Rev Immunol. 25: 821-52.
  • Rong Z, et al.. (2009) IL-17RD (Sef or IL-17RLM) interacts with IL-17 receptor and mediates IL-17 signaling. Cell Res. 19(2): 208-15.
  • Gaffen SL. (2009) Structure and signalling in the IL-17 receptor family. Nat Rev Immunol. 9(8): 556-67.
  • Size / Price
    Catalog: HG10507-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"