Quick Order

Human CST5 ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human CST5 cDNA Clone Product Information
NCBI RefSeq:NM_001900.4
RefSeq ORF Size:429bp
cDNA Description:Full length Clone DNA of Homo sapiens cystatin D with N terminal Myc tag.
Gene Synonym:CST5, MGC71922
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Cystatins are natural inhibitors of papain-like (family C1) and legumain-related (family C13) cysteine peptidases. The mammalian cystatin superfamily members are of three major types, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. As a member of type 2 cystatin, cystatin D is a single-domain protein and also has cysteine residues that form disulfide bridges. In contrast with the wider distribution of all the other family 2 cystatins, cystatin D is tissue-restricted expressed and has been found only in saliva and tears. and meanwhile, it displays an inhibition profile with a preferential inhibition on cathepsin S, H, L. Although the exact functions are largely unknown, it has reported that cystatin D is involved in the inhibition of virus replication and apoptosis.

Size / Price
Catalog: HG10506-NM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"