After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human LCN1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LCN1cDNA Clone Product Information
cDNA Size:531
cDNA Description:ORF Clone of Homo sapiens lipocalin 1 (tear prealbumin) DNA.
Gene Synonym:TP, PMFA, VEGP, MGC71975, LCN1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Lipocalin-1, also known as Von Ebner gland protein, VEG protein, Tear prealbumin, VEGP, Tear lipocalin and LCN1, is a secreted protein which belongs to the calycin superfamily and Lipocalin family. Human Lipocalin-1 / VEGP was originally described as a major protein of human tear fluid, which was thought to be tear specific. Lipocalin-1 / VEGP is identical with lingual von Ebner's gland protein, and is also produced in prostate, nasal mucosa and tracheal mucosa. Homologous proteins have been found in rat, pig and probably dog and horse. Lipocalin-1 / VEGP is an unusual lipocalin member, because of its high promiscuity for relative insoluble lipids and binding characteristics that differ from other members. Lipocalin-1 / VEGP acts as the principal lipid binding protein in tear fluid, a more general physiological function has to be proposed due to its wide distribution and properties. Lipocalin-1 / VEGP would be ideally suited for scavenging of lipophilic, potentially harmful substances and thus might act as a general protection factor of epithelia. Lipocalin-1 / LCN1 could play a role in taste reception. It could be necessary for the concentration and delivery of sapid molecules in the gustatory system. Lipocalin-1 / LCN1 can bind various ligands, with chemical structures ranging from lipids and retinoids to the macrocyclic antibiotic rifampicin and even to microbial siderophores. It exhibits an extremely wide ligand pocket.

  • Lassagne H. et al., 1993, Exp. Eye Res. 56:605-609.
  • Redl,B. et al., 2000, Biochim Biophys Acta  1482 (1-2):241-8.
  • Wojnar P. et al., 2001, J. Biol. Chem. 276:20206-20212.
  • Wojnar P. et al., 2003, J. Biol. Chem. 278:16209-16215.
  • Breustedt D.A. et al., 2005, J. Biol. Chem. 280:484-493.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items