Quick Order

Human NLK Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NLKcDNA Clone Product Information
cDNA Size:1584
cDNA Description:ORF Clone of Homo sapiens nemo-like kinase DNA.
Gene Synonym:FLJ21033, DKFZp761G1211, NLK
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Nemo-like kinase contains 1 protein kinase domain and belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family and MAP kinase subfamily. It also contains a TQE activation loop motif in which autophosphorylation of the threonine residue (Thr-298) is sufficient for kinase activation. As a serine/threonine-protein kinase, nemo-like kinase regulates a number of transcription factors with key roles in cell fate determination. It is a positive effector of the non-canonical Wnt signaling pathway, acting downstream of WNT5A, MAP3K7/TAK1 and HIPK2. Activation of this pathway causes binding to and phosphorylation of the histone methyltransferase SETDB1. The NLK-SETDB1 complex subsequently interacts with PPARG, leading to methylation of PPARG target promoters at histone H3K9 and transcriptional silencing. The resulting loss of PPARG target gene transcription inhibits adipogenesis and promotes osteoblastogenesis in mesenchymal stem cells (MSCs). Nemo-like kinase also is a negative regulator of the canonical Wnt/beta-catenin signaling pathway.

  • Smit L, et al. (2004) Wnt activates the Tak1/Nemo-like kinase pathway. J Biol Chem. 279(17): 17232-40.
  • Yasuda J, et al. (2004) Nemo-like kinase suppresses a wide range of transcription factors, including nuclear factor-kappaB. Cancer Sci. 95(1):52-7.
  • Yasuda J, et al. (2003) Nemo-like kinase induces apoptosis in DLD-1 human colon cancer cells. Biochem Biophys Res Commun. 308(2):227-335.
  • Ishitani T, et al. (2003) Regulation of lymphoid enhancer factor 1/T-cell factor by mitogen-activated protein kinase-related Nemo-like kinase-dependent phosphorylation in Wnt/beta-catenin signaling. Mol Cell Biol. 23(4):1379-89.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items