After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GOT1cDNA Clone Product Information
cDNA Size:1242
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) Aspartate aminotransferase, cytoplasmic DNA.
Gene Synonym:cCAT, cAspAT
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90649-ACG$325
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90649-ACR$325
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90649-ANG$325
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90649-ANR$325
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90649-CF$295
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90649-CH$295
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90649-CM$295
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90649-CY$295
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone)CG90649-G$95
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90649-NF$295
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90649-NH$295
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90649-NM$295
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90649-NY$295
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90649-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Aspartate aminotransferase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, aspartate aminotransferase and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. There is a rare in-frame deletion in aspartate aminotransferase gene, which inactivates cytosolic aspartate aminotransferase(cAST) enzyme in the Old Order Amish. This may help to understand structure and function of the enzyme and would be useful for predicting serum aspartate AST levels.

  • Shen H, et al. (2011) Genome-wide association study identifies genetic variants in GOT1 determining serum aspartate aminotransferase levels. J Hum Genet. 56(11):801-5.
  • Doonan S, et al. (1985) Structural and genetic relationships between cytosolic and mitochondrial isoenzymes. Int J Biochem. 16(12):1193-9.
  • Panteghini M. (1990) Aspartate aminotransferase isoenzymes. Clin Biochem. 23(4):311-9.
  • Bousquet-Lemercier B, et al. (1990) Properties of human liver cytosolic aspartate aminotransferase mRNAs generated by alternative polyadenylation site selection. Biochemistry. 29(22):5293-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks