Quick Order

Text Size:AAA

Human NCR2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NCR2cDNA Clone Product Information
cDNA Size:831
cDNA Description:ORF Clone of Homo sapiens natural cytotoxicity triggering receptor 2 DNA.
Gene Synonym:LY95, CD336, NKP44, NK-p44, dJ149M18.1, NCR2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Natural cytotoxicity triggering receptor 2 (NCR2), also known as Natural killer cell p44-related protein (NKp44), or CD336, is a member of the natural cytotoxicity receptor (NCR) family, which composed of one Ig-like extracellular domain, a transmembrane segment, and a cytoplasmic domain. It is a novel transmembrane glycoprotein belonging to the Immunoglobulin superfamily characterized by a single extracellular V-type domain. The cytoplasmic domain of NKp44 also contains a sequence that matches the immunoreceptor tyrosine-based inhibitory motif (ITIM) consensus. This Cytotoxicity-activating receptor that may contribute to the increased efficiency of activated natural killer (NK) cells to mediate tumor cell lysis. NKp44 is selectively expressed by IL-2-activated NK cells and may contribute to the increased efficiency of activated NK cells to mediate tumor cell lysis. Tumor cell recognition of the mutated NKp44 proteins was significantly reduced and correlated with their lower recognition of heparin.

  • Vitale M, et al. (1998) NKp44, a novel triggering surface molecule specifically expressed by activated natural killer cells, is involved in non-major histocompatibility complex-restricted tumor cell lysis. J Exp Med. 187(12): 2065-72.
  • Cantoni C, et al. (1999) NKp44, a triggering receptor involved in tumor cell lysis by activated human natural killer cells, is a novel member of the immunoglobulin superfamily. J Exp Med. 189: 787-96.
  • Cantoni C, et al. (2003) The three-dimensional structure of the human NK cell receptor NKp44, a triggering partner in natural cytotoxicity. Structure. 11(6): 725-34.
  • Campbell KS, et al. (2004) NKp44 triggers NK cell activation through DAP12 association that is not influenced by a putative cytoplasmic inhibitory sequence. J Immunol. 172(2): 899-906.
  • Hershkovitz O, et al. (2007) Characterization of the recognition of tumor cells by the natural cytotoxicity receptor, NKp44. Biochemistry. 46(25): 7426-36.