After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human CNTN2 / TAG-1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CNTN2cDNA Clone Product Information
cDNA Size:3123
cDNA Description:ORF Clone of Homo sapiens contactin 2 (axonal) DNA.
Gene Synonym:AXT, TAX, TAX1, TAG-1, FLJ42746, MGC157722, DKFZp781D102, CNTN2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed exclusively in the nervous system. The subgroup consists of six members: Contactin-1, Contactin-2(TAG-1), Contactin-3(BIG-1), BIG-2, Contactin-5(NB-2) and NB-3. Since their identification in the late 1980s, Contactin-1 and Contactin-2 have been studied extensively. Axonal expression and the neurite extension activity of Contactin-1 and Contactin-2 attracted researchers to study the function of these molecules in axon guidance during development. Contactin-1 and Contactin-2 have come to be known as the principal molecules in the function and maintenance of myelinated neurons. In contrast, the function of the other four members of this subgroup remained unknown until recently. Contactin-2, also known as CNTN2, is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. The human, rat, and chicken Contactin-2 are alternatively known as TAX1 (transiently-expressed axonal glycoprotein), TAG1 (transient axonal glycoprotein), and axonin-1, respectively. Human Contactin-2 shares approximately 91% and 75% amino acid sequence identity with rat and chicken Contactin-2, respectively. Contactin-2 is expressed by a subset of neuronal populations in the developing central nervous system (CNS) and peripheral nervous system (PNS). Contactin-2 is also expressed by oligodendrocytes and Schwann cells, which are myelinating glial cells of the CNS and PNS, respectively. Contactin-2 may play a role in the formation of axon connections in the developing nervous system. Contactin-2 is also involved in glial tumorigenesis and may provide a potential target for therapeutic intervention. During embryonic development, Contactin-2 interacts either in a homophilic, or heterophilic fashion with various transmembrane proteins.

  • Kyriakopoulou K, et al. (2002) A combination of chain and neurophilic migration involving the adhesion molecule TAG-1 in the caudal medulla. Development 129 (2):287-96.
  • Traka M, et al. (2002) The neuronal adhesion protein TAG-1 is expressed by Schwann cells and oligodendrocytes and is localized to the juxtaparanodal region of myelinated fibers. J Neurosci. 22(8):3016-24.
  • Traka M, et al. (2003) Association of TAG-1 with Caspr2 is essential for the molecular organization of juxtaparanodal regions of myelinated fibers. J Cell Biol. 162(6):1161-72.
  • Soares S, et al. (2005) Neuronal and glial expression of the adhesion molecule TAG-1 is regulated after peripheral nerve lesion or central neurodegeneration of adult nervous system. Eur J Neurosci. 21(5):1169-80.
  • Derfuss T, et al. (2009) Contactin-2/TAG-1-directed autoimmunity is identified in multiple sclerosis patients and mediates gray matter pathology in animals. Proc Natl Acad Sci U S A. 106(20):8302-7.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks