Quick Order

Human WISP1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human WISP1 cDNA Clone Product Information
Gene_bank_ref_id:NM_003882.2
RefSeq ORF Size:1104bp
cDNA Description:Full length Clone DNA of Homo sapiens WNT1 inducible signaling pathway protein 1 with N terminal Myc tag.
Gene Synonym:CCN4, WISP1c, WISP1i, WISP1tc, WISP1
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Background

CCN4/Wnt-induced secreted protein 1 (WISP1) is a secreted, cysteine-rich, heparin-binding glycoprotein, belonging to the CCN (CTGF/CYR61/NOV) family of growth factors, and is involved in diverse biological functions such as cell growth, adhesion, migration, angiogenesis, tissue repair, and regulation of extracellular matrix. Members of the CCN family demonstrate high structural homology sharing four conserved cysteine-rich modular domains: a IGFBP (insulin-like growthfactor-binding) domain, a von Willebrand type C domain, a thrombospondin domain and a C-terminal cysteine -knot domain. WISP1 is a putative downstream effector of the Wnt/Frizzled pathway that mediates diversedevelopmental processes, was identified as an oncogene regulated by the Wnt-1-beta-catenin pathway. Thus may contributes to Wnt-1-mediated tumorigenesis and malignance. Expression of WISP1 in some cells results in transformation and tumorigenesis. WISP1 acts to block cell death at a late stage in the p53-mediated apoptosis pathway. It was reported that WISP1 interacts with sulfated glycoconjugates, decorin and biglycan in the ECM of connective tissue, and possibly prevents their inhibitory activity in tumor cell proliferation.

References
  • Su F, et al. (2002) WISP-1 attenuates p53-mediated apoptosis in response to DNA damage through activation of the Akt kinase. Genes Dev. 16(1): 46-57.
  • Yanagita T, et al. (2007) Expression and physiological role of CCN4/Wnt-induced secreted protein 1 mRNA splicing variants in chondrocytes. FEBS J. 274(7): 1655-65.
  • Wang H, et al. (2009) Nitric oxide increases Wnt-induced secreted protein-1 (WISP-1/CCN4) expression and function in colitis. J Mol Med. 87(4): 435-45.
  • Venkatachalam K, et al. (2009) WISP1, a pro-mitogenic, pro-survival factor, mediates tumor necrosis factor-alpha (TNF-alpha)-stimulated cardiac fibroblast proliferation but inhibits TNF-alpha-induced cardiomyocyte death. J Biol Chem. 284(21): 14414-27.
  • Size / Price
    Catalog: HG10442-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"