Quick Order

Text Size:AAA

Human METTL1 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human METTL1 cDNA Clone Product Information
Gene_bank_ref_id:NM_005371.5
RefSeq ORF Size:831bp
cDNA Description:Full length Clone DNA of Homo sapiens methyltransferase like 1 with C terminal Myc tag.
Gene Synonym:TRM8, C12orf1, YDL201w, FLJ95748, METTL1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

tRNA (guanine-N(7)-)-methyltransferase, also known as Methyltransferase-like protein 1, tRNA (m7G46)-methyltransferase and METTL1, is a nucleus protein which belongs to the methyltransferase superfamily and TrmB family. METTL1 gene, has been identified by its sequence similarity to the yeast ORF YDL201w. The human cDNA and the genomic structure of METTL1 have been analyzed. The transcript contains 1292 nucleotides and codes for a protein of 276 amino acids. The METTL1 gene product shows high sequence similarities to putative proteins from mouse, Drosophila melanogaster, Arabidopsis thaliana, Caenorhabditis elegans, and yeast (39.8% identity between all six species). Computer analyses of the deduced protein sequence reveal two highly conserved amino acid motifs, one of which is typical for methyltransferases. Both motifs are also present in hypothetical proteins from eubacteria. Disruption of the homologous yeast ORF YDL201w shows that the gene is at least not essential for vegetative growth in Saccharomyces cerevisiae.

References
  • Bahr, A.et al., 1999, Genomics. 57 (3):424-8.
  • Wikman, H. et al., 2005,Genes Chromosomes Cancer. 42 (2):193-9.
  • Cartlidge, RA. et al., 2005, EMBO J. 24 (9):1696-705.
  • Size / Price
    Catalog: HG11525-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"