Quick Order

Text Size:AAA

Human ENPP5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ENPP5cDNA Clone Product Information
Gene_bank_ref_id:NM_021572.4
cDNA Size:1434
cDNA Description:ORF Clone of Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function) DNA.
Gene Synonym:KIAA0879, ENPP5
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

ENPP5 is a member of the nucleotide pyrophosphatase/phosphodiesterase family(NPP). It is a family comprised by dimeric enzymes that catalyze the hydrolysis of phosphate diester bonds. There are seven isoforms in NPP family, some of which prefer nucleotide substrates, some of which prefer phospholipid substrates, and others of which prefer substrates that have not yet been determined. NPP also belongs to the alkaline phosphatase (AP) superfamily of enzymes and they are located in the cell membrane and hydrolyze extracellular phosphate diesters to affect a wide variety of biological processes. ENPP5 belongs to a group of nucleotidemetabolizing ectoenzymes, which regulate the availability of extracellular nucleotides. ENPP5 may play a role in neuronal cell communication. Hhowever, it lacks nucleotide pyrophosphatase and lysopholipase D activity. It may also be involved in neuronal cell communication. The amino acid sequence of human ENPP5 is 100%, 88%, and 82% identical to that of chimpanzee, dog and mouse/rat. ENPP5 functions in phospholipid metabolism.

References
  • Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"