After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human IGFBP3 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IGFBP3 cDNA Clone Product Information
Gene_bank_ref_id:NM_000598.4
RefSeq ORF Size:876bp
cDNA Description:Full length Clone DNA of Homo sapiens insulin-like growth factor binding protein 3 with N terminal Myc tag.
Gene Synonym:IBP3, BP-53, IGFBP3
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Background

The Insulin-like Growth Factor (IGF) signaling system plays a central role in cellular growth, differentiation and proliferation. IGFBP3 is the most abundant IGF binding protein in human serum and has been shown to be a growth inhibitory, apoptosis-inducing molecule, capable of acting via IGF-dependent and IGF-independent mechanisms. It appears to function both by cell cycle blockade and the induction of apoptosis. IGFBP3 can be transported to the nucleus by an importin beta mediated mechanism, where it has been shown to interact with the retinoid X receptor alpha and possibly other nuclear elements. IGFBP3 antiproliferative signalling appears to require an active transforming growth factor beta (TGF-beta) signalling pathway, and IGFBP3 stimulates phosphorylation of the TGF-beta signalling intermediates Smad2 and Smad3. IGFBP3 has IGF-independent roles in inhibiting cell proliferation in cancer cell lines. Nuclear transcription factor, retinoid X receptor (RXR)-alpha, and IGFBP3 functionally interact to reduce prostate tumor growth and prostate-specific antigen in vivo. Several clinical studies have proposed that individuals with IGFBP3 levels in the upper range of normal may have a decreased risk for certain common cancers. This includes evidence of a protective effect against breast cancer, prostate cancer, colorectal cancer, and lung cancer. Moreover, IGFBP3 inhibits insulin-stimulated glucose uptake into adipocytes independent of IGF.

References
  • Baxter RC. (2001) Signalling pathways involved in antiproliferative effects of IGFBP-3: a review. Mol Pathol. 54(3): 145-8.
  • Butt AJ, et al. (2001) IGFBP-3 and apoptosis--a license to kill? Apoptosis. 6(3): 199-205.
  • Ali O, et al. (2003) Epidemiology and biology of insulin-like growth factor binding protein-3 (IGFBP-3) as an anti-cancer molecule. Horm Metab Res. 35(11-12): 726-33.
  • Yamada PM, et al. (2009) Perspectives in mammalian IGFBP-3 biology: local vs. systemic action. Am J Physiol Cell Physiol. 296(5): C954-76.
  • Size / Price
    Catalog: HG10430-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"