Quick Order

Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MAP2K6cDNA Clone Product Information
cDNA Size:1005
cDNA Description:ORF Clone of Homo sapiens mitogen-activated protein kinase kinase 6 (MAP2K6) DNA.
Gene Synonym:MEK6, MKK6, MAPKK6, PRKMK6, SAPKK3, MAP2K6
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10422-ACG$325
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10422-ACR$325
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10422-ANG$325
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10422-ANR$325
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10422-CF$295
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10422-CH$295
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10422-CM$295
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10422-CY$295
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone)HG10422-M$95
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10422-M-F$295
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10422-M-N$295
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10422-NF$295
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10422-NH$295
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10422-NM$295
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10422-NY$295
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10422-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Dual specificity mitogen-activated protein kinase kinase 6, also known as MAP kinase kinase 6, MAPKK 6, MAPK / ERK kinase 6, SAPKK3, MAP2K6 and MKK6, is a protein which belongs to the?protein kinase superfamily, STE Ser / Thr protein kinase family and MAP kinase kinase subfamily. MAP2K6 / MKK6 contains one?protein kinase domain. Mitogen-activated protein kinases are members of a conserved cascade of kinases involved in many signal transduction pathways. They stimulate phosphorylation of transcription factors in response to extracellular signals such as growth factors, cytokines, ultraviolet light, and stress-inducing agents. MAP2K6 / MKK6 exists in a variety of alternatively spliced isoforms with distinct patterns of tissue expression. Isoform 2 of MAP2K6 / MKK6 is only expressed in skeletal muscle. Isoform 1 of MAP2K6 / MKK6 is expressed in skeletal muscle, heart, and in lesser extent in liver or pancreas.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items