After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CD89 / FCAR transcript variant 1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FCAR cDNA Clone Product Information
NCBI RefSeq:NM_002000.2
RefSeq ORF Size:864bp
cDNA Description:Full length Clone DNA of Homo sapiens Fc fragment of IgA, receptor for (FCAR), transcript variant 1 with N terminal Myc tag.
Gene Synonym:CD89, FCAR
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

FCAR, also called FcαRI or CD89, is a type I  transmembrane receptor for Fc region of IgA which is the most abundant immunoglobulin in mucosal areas but is only the second most common antibody isotype in serum. This receptor is present on the surface of myeloid lineage cells such as neutrophils, monocytes, macrophages, and eosinophils, especially phagocytes located in mucosal areas. Upon ligand IgA binding, FcαRI associates with the FcR γ signaling molecule bearing the immunoreceptor tyrosine-based activation motif (ITAM) through a unique charge-based mechanism and triggers multiple cell-mediated immune responses. It has been reported that Fc RI is a dual-function receptor that can mediate both inflammatory and anti-inflammatory responses depending on the type of interaction with its ligand. Sustained aggregation of FCAR results in activation of target-cell functions such as antigen presentation and cytokine release. In contrast, Monomeric targeting with serum IgA or with a variety of anti-FcαRI Fab fragments triggers an inhibitory response and additionally induces apoptosis. FcαRI thus play an fundamental role in preventing tumor development and growth, as well as in controlling inflammation.

References
  1. Maliszewski, C.R. et al., 1990, J. Exp. Med. 172: 1665-1672.
  2. Launay, P. et al., 1999, J. Biol. Chem. 274: 7216-7225.
  3. Monteiro, R.C. et al., 2003, Annu. Rev. Immunol. 21: 177-204.
  4. Otten, M.A. et al., 2005, J. Immunol. 174: 5472-5480.
  5. Pasquier, B. et al., 2005, Immunity. 22:31-42.
  6. Kanamaru, Y. et al., 2007, Blood. 109: 203-211.
Size / Price
Catalog: HG10414-NM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"