Quick Order

Human TIMP2 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TIMP2 cDNA Clone Product Information
Gene_bank_ref_id:NM_003255.4
RefSeq ORF Size:663bp
cDNA Description:Full length Clone DNA of Homo sapiens TIMP metallopeptidase inhibitor 2 (TIMP2) with N terminal Myc tag.
Gene Synonym:CSC-21K, TIMP2
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Tissue inhibitors of metalloproteinases (TIMP) family are natural inhibitors of the matrix metalloproteinases (MMPs), the zinc enzymes involved in extracellular matrix maintenance and remodeling. The TIMP family encompasses four members (TIMP1-4), and they inhibit most MMPs by forming non-covalent binary complex. TIMP2 is a 22 kDa non N-glycosylated protein expressed by a variety of cell types, and plays a unique role among TIMP family members owing to its functions to regulate cellular responses to growth factors. Findings establish an unexpected, MMP-independent mechanism for TIMP2 inhibition of endothelial cell proliferation in vitro and reveal an important component of the antiangiogenic effect of TIMP2 in vivo. TIMP-2 thus is critical to the maintenance of tissue homeostasis and is involved in the regulation of tumor microenvironment.

References
  • Stetler-Stevenson, W.G. et al., 1992, Matrix. Suppl.1: 299-306.
  • Stetler-Stevenson, W.G. et al., 2005, Trends. Mol. Med. 11: 97-103.
  • Seo, D.W. et al., 2003, Cell. 114: 171-180.
  • Size / Price
    Catalog: HG10396-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"