Quick Order

Cynomolgus monkey VSNL1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus VSNL1 cDNA Clone Product Information
Gene_bank_ref_id:XM_005576507.1
RefSeq ORF Size:576bp
cDNA Description:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) visinin-like 1 with C terminal His tag.
Gene Synonym:VILIP
Species:Cynomolgus
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

VILIP-1, also known as VSNL1, is strongly expressed in granule cells of the cerebellum where it associates with membranes in a calcium-dependent manner and modulates intracellular signaling pathways of the central nervous system by directly or indirectly regulating the activity of adenylyl cyclase. VILIP-1 gene is a member of the visinin/recoverin subfamily of neuronal calcium sensor proteins. Alternatively spliced transcript variants have been observed, but their full-length nature has not been determined.

References
  • Burgoyne RD. 2007, Nat Rev Neurosci. 8 (3): 182-93.
  • Kose A. et al., 1990, Brain Res. 518 (1-2): 209-17.
  • Polymeropoulos MH. et al., 1996, Genomics. 29 (1): 273-5.
  • Size / Price
    Catalog: CG90557-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"