Quick Order

Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SHHcDNA Clone Product Information
Gene_bank_ref_id:NM_000193.2
cDNA Size:1389
cDNA Description:ORF Clone of Homo sapiens sonic hedgehog homolog (Drosophila) DNA.
Gene Synonym:TPT, HHG1, HLP3, HPE3, SMMCI, TPTPS, MCOPCB5, SHH
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10372-ACG$325
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10372-ACR$325
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10372-CF$295
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10372-CH$295
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10372-CM$295
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10372-CY$295
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone)HG10372-M$95
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10372-M-F$295
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, HA-taggedHG10372-M-Y$295
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10372-NF$295
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10372-NH$295
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10372-NM$295
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10372-NY$295
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10372-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Sonic HedgeHog, also known as sonic hedgehog protein, belongs to the hedgehog family. It cannot be detected in adult tissues while can be found in fetal intestine, liver, lung, and kidney. Sonic HedgeHog is a protein that is vital in guding the early embryo. It has been associated as the major inductive signal in patterning of the ventral neural tube, the anterior-posterior limb axis, and the ventral somites. Sonic HedgeHog intercellular signal is essential for a various patterning events during development: signal produced by the notochord that induces ventral cell fate in the neural tube and somites, and the polarizing signal for patterning of the anterior-posterior axis of the developing limb bud. Sonic HedgeHog binds to the patched receptor, which functions in association with smoothened, to activate the transcription of target genes. In the absence of sonic HedgeHog, patched receptor represses the constitutive signaling activity of smoothened. Sonic HedgeHog also regulates another factor, the gli oncogene. Defects in sonic hedgehog can cause microphthalmia isolated with coloboma type 5, triphalangeal thumb-polysyndactyly syndrome and holoprosencephaly type 3.

References
  • Ericson J, et al. (1997) Graded sonic hedgehog signaling and the specification of cell fate in the ventral neural tube. Cold Spring Harb Symp Quant Biol. 62:451-66.
  • Marigo V, et al. (1996) Regulation of patched by sonic hedgehog in the developing neural tube. Proc Natl Acad Sci. 93(18):9346-51.
  • Stone DM, et al. (1996) he tumour-suppressor gene patched encodes a candidate receptor for Sonic hedgehog. Nature. 384:129-34.
  • Size / Price
    Catalog:HG10372-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"