Quick Order

Text Size:AAA

Human STIM1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
STIM1cDNA Clone Product Information
cDNA Size:2058
cDNA Description:ORF Clone of Homo sapiens stromal interaction molecule 1 DNA.
Gene Synonym:GOK, D11S4896E, STIM1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Stromal interaction molecule 1, also known as STIM1 and GOK, is a cell membrane, a single-pass type I  membrane protein and a endoplasmic reticulum membrane protein. STIM1 / GOK is ubiquitously expressed in various human primary cells and tumor cell lines. It contains one EF-hand domain and one SAM (sterile alpha motif) domain. STIM1 / GOK plays a role in mediating Ca2+ influx following depletion of intracellular Ca2+ stores. It acts as Ca2+ sensor in the endoplasmic reticulum via its EF-hand domain. Upon Ca2+ depletion, STIM1 / GOK translocates from the endoplasmic reticulum to the plasma membrane where it activates the Ca2+ release-activated Ca2+ (CRAC) channel subunit, TMEM142A / ORAI1. Transfection of STIM1 / GOK into cells derived from a rhabdoid tumor and from a rhabdomyosarcoma that do not express detectable levels of STIM1 can induce cell death, suggesting a possible role in the control of rhabdomyosarcomas and rhabdoid tumors. Defects in STIM1 are the cause of immune dysfunction with T-cell inactivation due to calcium entry defect type 2 (IDTICED2) which is an immune disorder characterized by recurrent infections, impaired T-cell activation and proliferative response, decreased T-cell production of cytokines, lymphadenopathy, and normal lymphocytes counts and serum immunoglobulin levels.

  • Sabbioni S. et al., 1997, Cancer Res. 57: 4493-7.
  • Manji S.S. et al., 2000, Biochim. Biophys. Acta 1481: 147-55.
  • Williams R.T. et al., 2002, Biochim. Biophys. Acta. 1596: 131-7.
  • Spassova M.A. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 4040-5.
  • Parvez S. et al., 2008, FASEB J. 22: 752-61.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items