After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CTRCcDNA Clone Product Information
cDNA Size:807
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) chymotrypsin C (caldecrin) DNA.
Gene Synonym:CTRC
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90522-ACG$325
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90522-ACR$325
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90522-ANG$325
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90522-ANR$325
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90522-CF$295
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90522-CH$295
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90522-CM$295
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90522-CY$295
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90522-NF$295
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90522-NH$295
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90522-NM$295
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90522-NY$295
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone)CG90522-U$95
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90522-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Chymotrypsin C (abbreviated for CTRC), also known as caldecrin or elastase4, is a digestive enzyme of the peptidase S1 family. This enzyme is synthesized as an inactivate chymotrypsinogen. On cleavage by trypsin into two parts that activate each other by removing two small peptides in a trans-proteolysis, chymotrypsin C produced. N-linked glycosylation of human CTRC is required for efficient folding and secretion, however, the N-linked glycan is unimportant for enzyme activity or inhibitor binding. It has been proposed that CTRC is a key regulator of digestive zymogen activation and a physiological co-activator of digestive carboxypeptidases proCPA1 and proCPA2. Mutations that abolish activity or secretion of CTRC increase the risk for chronic pancreatitis. It's speculated that CTRC might regulate pancreatic cancer cell migration in relation to cytokeratin 18 expression. The pancreatic cancer cell migration ability was downregulated in pancreatic cancer Aspc-1 cells that overexpressed CTRC, whereas the cell migration ability was upregulated in Aspc-1 cells in which CTRC was suppressed. 

  • Lacruz RS, et al. (2011) Chymotrypsin C (caldecrin) is associated with enamel development. J Dent Res. 90 (10): 1228-33.
  • Zhou J, et al. (2011) Chymotrypsin C mutations in chronic pancreatitis. J Gastroenterol Hepatol. 26 (8): 1238-46.
  • Wang H, et al. (2011) Effect of chymotrypsin C and related proteins on pancreatic cancer cell migration. Acta Biochim Biophys Sin (Shanghai). 43 (5): 362-71.