Quick Order

Text Size:AAA

Human SLPI Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SLPIcDNA Clone Product Information
Gene_bank_ref_id:NM_003064.2
cDNA Size:399
cDNA Description:ORF Clone of Homo sapiens secretory leukocyte peptidase inhibitor DNA.
Gene Synonym:ALP, MPI, ALK1, BLPI, HUSI, WAP4, WFDC4, HUSI-I
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human SLPI Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Related Products
Product nameProduct name
Background

Secretory leukoprotease inhibitor (SLPI), also called antileukoprotease (ALP), is a 12-kDa, nonglycosylated serine protease inhibitor present in mucous secretions. It is thought to play a role in protecting the mucosae from injury associated with inflammation. SLPI is locally produced by serous cells, including bronchial submucosal glands. Elafin and SLPI are members of larger families of proteins secreted predominantly at mucosal sites, and have been shown to be modulated in multiple pathological conditions. Elafin and SLPI are structurally related in that both have a fold with a four-disulfide core or whey acidic protein (WAP) domain responsible for inhibiting proteases. SLPI is a prominent innate immune protein of the respiratory tract, possessing serine protease inhibitor activity, antibacterial activity, and anti-inflammatory/immunomodulatory activity.

References
  • Moreau T, et al. (2008) Multifaceted roles of human elafin and secretory leukocyte proteinase inhibitor (SLPI), two serine protease inhibitors of the chelonianin family. Biochimie. 90(2): 284-95.
  • Weldon S, et al. (2007) Innate host defense functions of secretory leucoprotease inhibitor. Exp Lung Res. 33(10): 485-91.
  • Williams SE, et al. (2006) SLPI and elafin: one glove, many fingers. Clin Sci (Lond). 110(1): 21-35.
  • Kikuchi T, et al. (1996) Regulation of secretory leukoprotease inhibitor gene expression. Nihon Rinsho. 54(2): 405-10.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"