Quick Order

Human CD50 / ICAM3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ICAM3cDNA Clone Product Information
cDNA Size:1644
cDNA Description:ORF Clone of Homo sapiens intercellular adhesion molecule 3 DNA.
Gene Synonym:CD50, CDW50, ICAM-R
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human CD50 / ICAM3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Related Products
Product nameProduct name

The protein ICAM-3, also known as CD50, is a member of the intercellular adhesion molecule (ICAM) family consisting three members. It is a DC-SIGN ligand that is constitutively expressed on resting leukocytes, and is thus an important molecule for the first immune response. ICAM-3 comprises of five immunoglobulin-like domains, and binds LFA-1 through its two N-terminal domains. It functions not only as an adhesion molecule, but also as a potent signalling molecule. ICAM-3 binds to LFA-1 on antigen-presenting cells (APC) stabilizing the T cell-APC interaction, facilitating signaling through the CD3/TCR complex. However, recent evidence using cultured and transformed T cells suggests ICAM-3 may also function in signaling. It has been reported that CD50 molecule can play a role in developing functionally mature T lymphocytes and its expression increases during the maturation process of T lymphocytes. In addition, the interactions of ICAM-3 and LFA-1 facilitate HIV-1- induced virological synapse formation between T cells. ICAM-3 is associated with an increase of cellular radio-resistance and cancer cell proliferation. It could be considered as a candidate for anti-cancer drug development and as a cancer diagnostic marker.

  • Berney SM, et al. (1999) ICAM-3 (CD50) cross-linking augments signaling in CD3-activated peripheral human T lymphocytes. J Leukoc Biol. 65(6): 867-74.
  • van Buul JD, et al. (2004) ICAM-3 activation modulates cell-cell contacts of human bone marrow endothelial cells. J Vasc Res. 41(1): 28-37.
  • Sugino H. (2005) ICAM-3, a ligand for DC-SIGN, was duplicated from ICAM-1 in mammalian evolution, but was lost in the rodent genome. FEBS Lett. 579(13): 2901-6.
  • Park JK, et al. (2010) ICAM-3 enhances the migratory and invasive potential of human non-small cell lung cancer cells by inducing MMP-2 and MMP-9 via Akt and CREB. Int J Oncol. 36(1): 181-92.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items