After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human B3GNT2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
B3GNT2cDNA Clone Product Information
Gene_bank_ref_id:NM_006577.5
cDNA Size:1194
cDNA Description:ORF Clone of Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 DNA.
Gene Synonym:B3GN-T2, B3GNT, B3GNT-2, B3GNT1, BETA3GNT, BGNT2, BGnT-2
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

B3GNT2 belongs to the beta-1,3-N-acetylglucosaminyltransferase family. It is a type II transmembrane protein which prefers the substrate of lacto-N-neotetraose. Alternative splicing produced 2 isoforms of the human protein. B3GNT2 catalyzes the initiation and elongation of poly-N- acetyllactosamine chains. Enzymatic activities of some glycosyltransferases are markedly increased via complex formation with other transferases or cofactor proteins. B3GNT2 and beta3Gn-T8 can form a heterodimer in vitro and that the complex exhibits much higher enzymatic activity than either enzyme alone. It is found that up-regulation of beta3Gn-T8 in differentiated HL-60 cells may increases poly-N-acetyllactosamine chains by activating intrinsic B3GNT2.

References
  • Australo-An, et al. (2010) Genome-wide association study of ankylosing spondylitis identifies non-MHC susceptibility loci. Nat Genet. 42(2):123-7.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Seko A, et al. (2008) Activation of beta1,3-N-acetylglucosaminyltransferase-2 (beta3Gn-T2) by beta3Gn-T8. Possible involvement of beta3Gn-T8 in increasing poly-N-acetyllactosamine chains in differentiated HL-60 cells. J Biol Chem. 283(48):33094-100.
  • Size / Price
    Catalog:HG11416-CM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"