Quick Order

Text Size:AAA

Human HGFA Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HGFAcDNA Clone Product Information
cDNA Size:1968
cDNA Description:ORF Clone of Homo sapiens HGF activator DNA.
Gene Synonym:HGFA, MGC138395, MGC138397
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

HGF activator (HGFA) is a serum-derived serine protease and belongs to the peptidase family S1.HGFA is responsible for the conversion of hepatocyte growth factor (HGF), from the inactive single-chain precursor to the active heterodimeric form, which is a potent mitogen, motogen, and morphogen for liver cells, epithelial cells, and endothelial cells. HGFA is synthesized and secreted by the liver and circulates in the plasma as an inactive single-chain zymogen in normal states. The zymogen is cleaved by thrombin or thermolysin through the endoproteolytic process and forms an active heterodimer linked by a disulfide bond. In turn, the active protease can be inhibited by HGFA inhibitors (HAIs) including HAI-1 and HAI-2. In addition, the HGFA zymogen acquires a strong affinity upon activation and thus may ensure the local action in tissue regeneration in liver, kidney and skin. It has been reported that activation of HGF is a critical limiting step in the HGF/SF-induced signaling pathway mediated by Met, and accordingly, aberrant expression of HGFA is implicated in tumorigenesis and progression.


1.  Shimomura, T. et al., 1993, J. Biol. Chem. 268: 22927-22932.

2.  Miyazawa, K. et al., 1996, J. Biol. Chem. 271 : 3615-3618.

3.  Shia, S. et al., 2005, J. Mol. Biol. 346: 1335-1349.

4.  Kataoka, H. et al., 2000, J. Biol. Chem. 275: 40453-40462.

5.  Tjin, E.P. et al., 2006, Blood. 107: 760-768.

6.  Kitajima, Y. et al., 2000, Cancer. Res. 60: 6148-6159.

Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items