Quick Order

Text Size:AAA

Human SULT2A1 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SULT2A1 cDNA Clone Product Information
Gene_bank_ref_id:NM_003167.3
RefSeq ORF Size:858bp
cDNA Description:Full length Clone DNA of Homo sapiens sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 with C terminal Myc tag.
Gene Synonym:HST, ST2, STD, hSTa, DHEAS, ST2A3, DHEA-ST, SULT2A1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Hydroxysteroid sulfotransferase ( SULT2A1 ) is a key enzyme in the testicular and hepatic metabolism of 5alpha-androstenone, which is a major component of the off-odor and off-flavor in pork known as boar taint. Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. SULT2A1 is a sulfo-conjugating phase II enzyme expressed at very high levels in the liver and intestine, the two major first-pass metabolic tissues, and in the steroidogenic adrenal tissue. SULT2A1 acts preferentially on the hydroxysteroids dehydroepiandrosterone, testosterone/dihydrotestosterone, and pregnenolone and on cholesterol-derived amphipathic sterol bile acids.

References
  • Chatterjee, B. 2005, Methods Enzymol. 400:165-91.
  • Liu,Y. et al., 2006, Chem Res Toxicol. 19 (11):1420-5.
  • Sinclair, PA. et al., 2006, J Mol Endocrinol  36 (2):301-11.
  • Yalcin, EB. et al., 2008, Drug Metab Lett  2 (3):198-204.
  • Size / Price
    Catalog: HG11411-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"