Quick Order

Text Size:AAA

Human SULT1A3 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SULT1A3 cDNA Clone Product Information
Gene_bank_ref_id:NM_003166.3
RefSeq ORF Size:888bp
cDNA Description:Full length Clone DNA of Homo sapiens angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 with C terminal Myc tag.
Gene Synonym:STM, HAST, HAST3, M-PST, ST1A5, TL-PST, SULT1A4, MGC117469, SULT1A3
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

SULT1A3 belongs to the sulfotransferase 1 family. Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. They are different in their tissue distributions and substrate specificities while their gene structure (number and length of exons) is similar. SULT1A3 gene encodes a phenol sulfotransferase with thermolabile enzyme activity. Four sulfotransferase genes are located on the p arm of chromosome 16; this gene and SULT1A4 arose from a segmental duplication. It is the most centromeric of the four sulfotransferase genes. Exons of this gene overlap with exons of a gene that encodes a protein containing GIY-YIG domains (GIYD1). SULT1A3 is expressed in liver, colon, kidney, lung, brain, spleen, small intestine, placenta and leukocyte. SULT1A3 is a sulfotransferase that utilizes 3'-phospho-5'-adenylyl sulfate (PAPS) as sulfonate donor to catalyze the sulfate conjugation of phenolic monoamines (neurotransmitters such as dopamine, norepinephrine and serotonin) and phenolic and catechol drugs.

References
  • Dajani R, et al. (1999) Kinetic properties of human dopamine sulfotransferase (SULT1A3) expressed in prokaryotic and eukaryotic systems: comparison with the recombinant enzyme purified from Escherichia coli. Protein Expr. Purif. 16 (1): 11-8.
  • Dajani R, et al. (2000) X-ray crystal structure of human dopamine sulfotransferase, SULT1A3. J. Biol. Chem. 274 (53): 37862-8.
  • Yasuda S, et al. (2011) Sulfation of chlorotyrosine and nitrotyrosine by human lung endothelial and epithelial cells: role of the human SULT1A3. Toxicol Appl Pharmacol. 251 (2): 104-9.
  • Hildebrandt MA, et al. (2004) Human SULT1A3 pharmacogenetics: gene duplication and functional genomic studies. Biochem Biophys Res Commun. 321 (4): 870-8.
  • Lu JH, et al. (2005) Crystal structure of human sulfotransferase SULT1A3 in complex with dopamine and 3'-phosphoadenosine 5'-phosphate. Biochem Biophys Res Commun. 335 (2): 417-23.
  • Size / Price
    Catalog: HG11408-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"