Quick Order

Text Size:AAA

Cynomolgus monkey CA10 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus CA10 cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:987bp
cDNA Description:Full length Clone DNA of Macaca mulatta carbonic anhydrase X with C terminal His tag.
Gene Synonym:CA10
Species:Cynomolgus
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Carbonic anhydrase X, also called carbonic anhydrase - related protein X (CARPX) and CA10, belongs to the CA family of zinc metalloenzymes which catalyze the reversible hydration of carbon dioxide in various biological processes such as respiration, renal tubular acidification and bone resorption. The secreted protein CARPX without CA activity (hydration of CO2) is identified as an acatalytic member of the alpha-carbonic anhydrase subgroup. CARP X expression is detected in the adult total brain and almost all parts of the central nervous system, but not in the fetal brain. Accordingly, CARP X is suggested to play a role in the development of central nervous system, especially the brain. The same CARP X protein are encoded by multiple transcript variants of this gene.

References
  • Okamoto, N. et al., 2001, Biochim. Biophys. Acta 1518:311-316.
  • Taniuchi, K. et al., Neuroscience 112: 93-99.
  • Supuran, C.T. et al., 2003, Med. Res. Rev. 23: 146-189.
  • Size / Price
    Catalog: CG90489-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"