Quick Order

Human SerpinF2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SERPINF2cDNA Clone Product Information
Gene_bank_ref_id:NM_000934.3
cDNA Size:1476
cDNA Description:ORF Clone of Homo sapiens serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2 DNA.
Gene Synonym:AAP, API, PLI, A2AP, ALPHA-2-PI
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

SerpinF2, also known as alpha-2 antiplasmin (alpha-2 AP), is a member of the Serpin superfamily. SerpinF2 is the principal physiological inhibitor of serine protease plasmin, and as well as, an efficient inhibitor of trypsin and chymotrypsin. This protease is produced mainly by liver and kidney, and also expressed in muscle, intestine, central nervous system, and placenta also express this protein at a moderate level. It is indicated that Serpin F2 is a key regulator of plasmin-mediated proteolysis in these tissues. Alpha-2 AP is an unusual serpin in that it contains extensive N- and C-terminal sequences flanking the serpin domain. The N-terminal sequence is crosslinked to fibrin by factor XIIIa, whereas the C-terminal region mediates the initial interaction with plasmin. SerpinF2 is one of the inhibitors of fibrinolysis, which acts as the primary inhibitor of plasmin(ogen). It is a specific plasmin inhibitor, and is important in modulating the effectiveness and persistence of fibrin with respect to its susceptibility to digestion and removal by plasmin. Alpha-2 AP plays the dominant role in inhibiting both plasma clot lysis and thrombus lysis, and accordingly, the congenital deficiency of Alpha-2 antiplasmin causes a rare bleeding disorder because of increased fibrinolysis. Thus, it may be a useful target for developing more effective treatment of thrombotic diseases.

References
  • Lee KN, et al. (2004) Alpha2-antiplasmin: potential therapeutic roles in fibrin survival and removal. Curr Med Chem Cardiovasc Hematol Agents. 2(4): 303-10.
  • Matsuno H. (2006) Alpha2-antiplasmin on cardiovascular diseases. Curr Pharm Des. 12(7): 841-7.
  • Burnouf T, et al. (2007) Impact of Triton X-100 on alpha 2-antiplasmin (SERPINF2) activity in solvent/detergent-treated plasma. Biologicals. 35(4): 349-53.
  • Carpenter SL, et al. (2008) Alpha2-antiplasmin and its deficiency: fibrinolysis out of balance. Haemophilia. 14(6): 1250-4.
  • Size / Price
    Catalog:HG10297-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"