Quick Order

Human HIST2H2BE ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HIST2H2BE cDNA Clone Product Information
Gene_bank_ref_id:NM_003528.2
RefSeq ORF Size:381bp
cDNA Description:Full length Clone DNA of Homo sapiens histone cluster 2, H2be with C terminal Myc tag.
Gene Synonym:H2B, H2BQ, GL105, H2B.1, H2BFQ, H2BGL105, MGC119802, MGC119804, MGC129733, MGC129734, HIST2H2BE
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Histones are a complex family of highly conserved basic proteins responsible for packaging chromosomal DNA into nucleosomes. Histone proteins exhibit two levels of diversity: 1. evolutionary diversity between species and 2. subtype diversity in a class(H1, H2A, H2B, H3 or H4) within a species. It has become more and more evident that histone modifications are key players in the regulation of chromatin states and dynamics as well as in gene expression. Therefore, histone modifications and the enzymatic machineries that set them are crucial regulators that can control cellular proliferation, differentiation, plasticity, and malignancy processes. However, extracellular histones are a double-edged sword because they also damage host tissue and may cause death. Histones bound to platelets, induced calcium influx, and recruited plasma adhesion proteins such as fibrinogen to induce platelet aggregation. Histone H2B proteins have been studied in a variety of species and is easily detecred in most species. The reversible ubiquitylation of histone H2B has long been implicated in transcriptional activation and gene silencing. Phosphorylation of H2B serine 32 occurs in normal cycling and mitogen-stimulated cells. Notably, this phosphorylation is elevated in skin cancer cell lines and tissues compared with normal counterparts. HIST2H2BE is a member of the histone H2B family, and generates two transcripts through the use of the conserved stem-loop termination motif, and the polyA addition motif.

References
  • Fuchs TA, et al. (2011) Histones induce rapid and profound thrombocytopenia in mice. Blood. 118(13): 3708-14.
  • Collart D, et al. (1993). A human histone H2B.1 variant gene, located on chromosome 1, utilizes alternative 3' end processing. J Cell Biochem. 50 (4): 374-85.
  • Marzluff WF, et al. (2002). The human and mouse replication-dependent histone genes. Genomics. 80 (5): 487-98.
  • Size / Price
    Catalog: HG11362-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"