Quick Order

Text Size:AAA

Human LY86 / MD-1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LY86 cDNA Clone Product Information
Gene_bank_ref_id:NM_004271.3.
RefSeq ORF Size:489bp
cDNA Description:Full length Clone DNA of Homo sapiens lymphocyte antigen 86 with N terminal Myc tag.
Gene Synonym:LY86, MD-1, MMD-1, dJ80N2.1, RP1-80N2.1
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

MD-1 and MD-2 are secretory glycoproteins that exist on the cell surface in complexes with transmembrane proteins. MD-1 is anchored by radioprotective 105 (RP105) which is a molecule containing leucine-rich repeats and is expressed on B cells, dentritic cells and macrophages, while MD-2 is associated with TLR4. MD-1 is required for efficient RP105 cell surface expression and function. It is indicated that the RP105/MD1 complex, in conjunction with TLR4, mediates the innate immune response to LPS in B cells, and also plays a role in protecting against apoptosis, B-cell proliferation, etc. Mouse MD-1 cDNA encodes a 162 amino acid precursor protein with a putative 19 aa signal peptide and two potential N-linked glycosylation sites. It shares 40% and 66% amino acid sequence identity with chicken and human MD-1 respectively. MD-1 is mainly expressed in spleen, and also detectable in liver, brain, thymus, and kidney.

Size / Price
Catalog: HG10242-NM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"