After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human FUT8 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FUT8 cDNA Clone Product Information
Gene_bank_ref_id:NM_178154.1
RefSeq ORF Size:1728bp
cDNA Description:Full length Clone DNA of Homo sapiens fucosyltransferase 8 (alpha (1,6) fucosyltransferase) with C terminal Myc tag.
Gene Synonym:MGC26465, FUT8
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Human alpha (1,6) fucosyltransferase 8, also known as FUT8, is a member of the glycosyltransferase family. Fucosyltransferases are the enzymes transferring fucose from GDP-Fuc to Gal in an alpha1,2-linkage and to GlcNAc in alpha1,3-linkage, alpha1,4-linkage, or alpha1,6-linkage. All fucosyltransferases utilize the same nucleotide sugar, their specificity reside in the recognition of the acceptor and in the type of linkage formed. Fucosyltransferases share some common structural and catalytic features. On the basis of protein sequence similarities, these enzymes can be classified into four distinct families: (1) the alpha-2-fucosyltransferases, (2) the alpha-3-fucosyltransferases, (3) the mammalian alpha-6-fucosyltransferases, and (4) the bacterial alpha-6-fucosyltransferases. The alpha-3-fucosyltransferases constitute a distinct family as they lack the consensus peptide, but some regions display similarities with the alpha-2 and alpha-6-fucosyltranferases.

References
  • Breton C, et al. (1998) Conserved structural features in eukaryotic and prokaryotic fucosyltransferases. Glycobiology. 8(1): 87-94.
  • Oriol R, et al. (1999) Divergent evolution of fucosyltransferase genes from vertebrates, invertebrates, and bacteria. Glycobiology. 9(4): 323-34.
  • de Vries T, et al. (2001) Fucosyltransferases: structure / function studies. Glycobiology. 11(10): 119-128.
  • Baboval T, et al. (2002) Comparison of human and mouse Fuc-TX and Fuc-TXI genes, and expression studies in the mouse. Mamm Genome. 13(9): 538-41.
  • Size / Price
    Catalog: HG11326-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"