After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey PNP Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PNPcDNA Clone Product Information
Gene_bank_ref_id:XM_005560695.1
cDNA Size:870
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) purine nucleoside phosphorylase DNA.
Gene Synonym:PNP
Species:Cynomolgus
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Cynomolgus monkey PNP Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Cynomolgus monkey PNP Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90410-ACG$325
Cynomolgus monkey PNP Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90410-ACR$325
Cynomolgus monkey PNP Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90410-ANG$325
Cynomolgus monkey PNP Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90410-ANR$325
Cynomolgus monkey PNP Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90410-CF$295
Cynomolgus monkey PNP Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90410-CH$295
Cynomolgus monkey PNP Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90410-CM$295
Cynomolgus monkey PNP Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90410-CY$295
Cynomolgus monkey PNP Gene cDNA Clone (full-length ORF Clone)CG90410-G$95
Cynomolgus monkey PNP Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90410-NF$295
Cynomolgus monkey PNP Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90410-NH$295
Cynomolgus monkey PNP Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90410-NM$295
Cynomolgus monkey PNP Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90410-NY$295
Cynomolgus monkey PNP Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90410-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
References
  • de Azevedo,W.F. et al., 2003, Biochem Biophys Res Commun. 312 (3): 767-72.
  • Canduri,F. et al., 2005, Acta Crystallogr D Biol Crystallogr. 61 (Pt 7): 856-62.
  • Perera,G.K. et al., 2005,Clin Exp Dermatol. 30 (1):27-9.
  • Size / Price
    Catalog:CG90410-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"