Quick Order

Text Size:AAA

Human GPNMB transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
GPNMBcDNA Clone Product Information
Gene Bank Ref.ID:NM_002510.2
cDNA Size:1683
cDNA Description:ORF Clone of Homo sapiens glycoprotein (transmembrane) nmb, transcript variant 2 DNA.
Gene Synonym:NMB, HGFIN, GPNMB
Restriction Site:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human GPNMB transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Related Products
Product nameProduct name

GPNMB belongs to the PMEL / NMB family, also known as Osteoactivin and Hematopoietic growth factor-inducible neurokinin 1 ( HGFIN ), is a transmembrane glycoprotein that is expressed in numerous cells, including osteoclasts, macrophages, dendritic cells, and tumor cells. It is suggested to influence osteoblast maturation, cell adhesion and migration. GPNMB protein acts as a downstream mediator of BMP-2 effects on osteoblast differentiation and function. GPNMB participates in bone mineralization, and functions as a negative regulator of inflammation in macrophages. Osteoactivin is expressed at high levels in normal and inflammatory liver macrophages suggesting a significant role in acute liver injury. The early-phase upregulation of Osteoactivin expression in the tubular epithelium in response to renal injury might play a role in triggering renal interstitial fibrosis via activation of matrix metalloproteinase expression and collagen remodeling in rats. Osteoactivin as a protein that is expressed in aggressive human breast cancers and is capable of promoting breast cancer metastasis to bone.

  • Pahl MV. et al., 2010, Clin J Am Soc Nephrol. 5(1): 56-61.
  • Abdelmagid SM. et al., 2008, Exp Cell Res. 314(13): 2334-51.
  • Haralanova-Ilieva B. et al., 2005, J Hepatol. 242(4): 565-72.
  • Abdelmagid SM. et al., 2007, J Cell Physiol. 210(1): 26-37.
  • Furochi H. et al., 2007, J Med Invest. 54(3-4): 248-54.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availsability:2-3 weeks